Characterization of Genetic Diversity of Cactus Species (Opuntia Spp.) in Morocco by Morphological Traits and Molecular Markers

Y. El Kharrassi1,2,6, M.A. Mazri4, M.H. Sedra3, A. Mabrouk1,5, B. Nasser2, E. El Mzouri1*

1Institut National de la Recherche Agronomique, CRRA de Settat, Service de Recherche et Développement, Route tertiaire, Settat, Morocco.

2Université Hassan I, Faculté des Sciences et Techniques, Laboratoire de Biochimie et Neurosciences, Settat, Morocco.

3Institut National de la Recherche Agronomique, CRRA de Marrakech, UR Protection des Plantes, Avenue Mohammed 6, Marrakech, Morocco.

4Institut National de la Recherche Agronomique, CRRA de Marrakech, UR Agro-Biotechnologie, Avenue Mohammed 6, Marrakech, Morocco.

5Université Hassan I, Faculté des Sciences et Techniques, Laboratoire d’Agro-alimentaire et Santé, Settat, Morocco.

6Mohammed VI Polytechnic University, School of Agriculture, Fertilizer and Environment Sciences: ESAFE, LOT 660-Hay Moulay Rachid, Ben Guérir, Morocco.

Corresponding author Email: elmzouriinras@gmail.com

DOI : http://dx.doi.org/10.12944/CARJ.5.2.01

Article Publishing History

Received: 27 July 2017
Accepted: 5 September 2017

Review Details

Plagiarism Check: Yes

Article Metrics

Views 

    PDF Download PDF Downloads: 1513

Google Scholar

Abstract:

The genetic diversity within and among 124 accessions of Opuntia spp. collected from different regions of Morocco was assessed using morphological descriptors and molecular markers. Based on 10 morphological traits, the accessions were separated into 3 main clusters; each cluster was containing accessions from different regions and species. Polymerase chain reaction (PCR) was then performed on 22 accessions from different regions and species, with 10 inter-simple sequence repeat (ISSR) primers and one random amplified polymorphic DNA (RAPD) primer. ISSR primers produced 66 bands overall, 64 (96.9 %) of which were polymorphic while 6 bands were generated by the RAPD marker, all polymorphic. The polymorphic information content (PIC) values ranged from 0.62 to 0.97, with an average of 0.82. The dendrogram of genetic differences generated using the unweighted pair-group method using arithmetic averages (UPGMA) method showed 7 different clusters at a similarity of 0.76, which was confirmed by the principal component analysis (PCA). The main conclusion of our work is the high genetic similarity between Opuntia ficus indica and Opuntia megacantha species in Morocco. Our results will be useful for plant breeding and genetic resource conservation programs.

Keywords:

Cactus pear; DNA; Genetic polymorphism; ISSR; Morphological descriptors; RAPD

Download this article as: 

Copy the following to cite this article:

El Kharrassi Y, Mazri M. A, Sedra M. H, Mabrouk A, , Nasser B, El Mzouri E. Characterization of Genetic Diversity of Cactus Species (Opuntia Spp.) in Morocco by Morphological Traits and Molecular Markers. Curr Agri Res 2017;5(2). doi : http://dx.doi.org/10.12944/CARJ.5.2.01

Copy the following to cite this URL:

El Kharrassi Y, Mazri M. A, Sedra M. H, Mabrouk A, , Nasser B, El Mzouri E. Characterization of Genetic Diversity of Cactus Species (Opuntia Spp.) in Morocco by Morphological Traits and Molecular Markers. Curr Agri Res 2017;5(2). Available from: http://www.agriculturejournal.org/?p=2625


Introduction

The cactus pear (Opuntia spp.) is a plant genus native to arid and semi-arid regions of Mexico.1 It belongs to the family Cactaceae, which is consisting of about 1500 species30 and it is widely distributed throughout temperate, subtropical and cold regions (Feugang et al. 2006).In Morocco, the cactus pear is one of the most important crop plants in the semi-arid zones. It covers an area of about 120000 ha5 and it is represented mainly by the species Opuntia ficus indica. The accessions of this species are classified into three distinct populations: (i) the Christians’ nopal with prickly cladodes used as a field fence; (ii) the Muslims’ nopal with inermis cladodes used as a green fodder for cattle and (iii) the Moses’ nopal with large inermis cladodes that produce big pears.20 The cactus pear population is present throughout the country, from Eastern to Southern Morocco,18 with predominance in Guelmim-Sidi Ifni and Haouz-El Kelâa des Sraghnas regions.5 Increasing the cactus pear area of cultivation is one of the strategies of the Moroccan Ministry of Agriculture. The cactus pear is a tree with high economic and ecologic value and various uses. It is cultivated for human consumption since it is characterized by important nutritional components.42 The cactus pear has also many beneficial effects on health, including anti-cancer effect, anti-viral effect and anti-diabetic-effect among others.23 On the other hand, the cactus pear may be utilized as forage due to its nutritional characteristics; along this line, Andrade-Montemayor et al. (2011)4 reported that cactus cladodes could be used for goats feeding in semi-arid regions. The cactus pear was also successfully used for feeding Santa Inês lambs 13 and dromedary camel.15 Furthermore, it was reported that some cactus constituents could be extracted and used as food additives or for pharmaceutical and cosmetic purposes.32 The process of agricultural intensification and modern agricultural practices has led to genetic diversity degradation and gene pools loss.2-28 Determining the level of genetic diversity among and within plant populations is primordial for genetic resources conservation and breeding programs.24-28 The use of morphological descriptors is of great help for genetic diversity assessment.14 In the recent years, molecular markers have been proven powerful to determine the genetic diversity among and within species 12 and could be used as complementary methods to morphological descriptors.14 Along this line, inter-simple sequence repeat (ISSR) and random amplified polymorphic DNA (RAPD) markers have been widely used to assess the genetic diversity in many species. Both the techniques are characterized by their simplicity, rapidity, ability to show high polymorphism with no prior knowledge of the genome studied.36-41 In the recent years, several studies have been carried out on the genetic diversity of the cactus pear. For example, Valadez-Moctezuma et al. (2014)39 studied the genetic diversity within and among Mexican Opuntia species using RAPD and ISSR markers. In Italy, Labra et al. (2003) 27 evaluated the genetic diversity in Opuntia species with cpSSR and AFLP markers. Zoghlami et al. (2007)44 have assessed the genetic diversity of Opuntia ficus indica L. in Tunisia using RAPD markers. More recently, Bendhifi et al. (2013)6 published another work on the genetic diversity of the same species in Tunisia using morphological descriptors and RAPD markers. Despite the high importance of the cactus pear in Morocco, its genetic diversity has been scarcely studied. Therefore, the aim of this investigation was to assess the genetic diversity within and among Opuntia spp. from different regions of Morocco, using morphological descriptors as well as ISSR and RAPD markers.

Materials and Methods

Plant Material

In the following investigation, we used 124 Opuntia spp. accessions belonging to different species: O. ficus indica; O. megacantha; O. robusta; O. aequatorialis; O. dillenii; O. leucotricha and O. inermis (identified for the first time in Morocco; Table 1). The accessions are planted in the experimental site called Ain Nzagh of National Institute of Agronomic Research-Regional Research Centre of Settat, (INRA-CRRA Settat, Morocco). Originally, the accessions were collected from different geographical sites of Morocco as shown in Table 1 and Figure 1 then planted in the experimental site in June 2011. All the accessions have undergone the same culture edaphoclimatic conditions.

Morphological Analysis

In this study, 10 quantitative morphological traits including plant height, plant diameter, average number of cladodes per plant, cladode height, cladode width, index of cladode shape (calculated as the ration of one-year-old cladodes length divided by their width), cladode thickness, mean distance between areoles, average number of spines per areole and mean length of the longest spine per areole. Data were recorded from 4 randomly chosen plants (2 years old) for each accession. Morphological data were subjected to analysis of variance (ANOVA) and means were separated with the Student-Newman-Keuls test at a 0.05 probability level. A proximity matrix was generated using Squared Euclidean distance then clustering of accessions was performed using Ward’s method. All statistical analyses were performed with SPSS v 16.0 software (IBM, Chicago, IL, USA).

Table 1: Means (+ SD) of morphological traits in different accessions of Opuntia spp. in Morocco *Mean values with the same letters are not significantly different (p> 0.05) (-): Absence of spine.

Species Geographic origin Accession Plant height (cm) Plant diameter (cm) Average number of cladodes per plant Cladode height (cm) Cladode width (cm) Index of cladode shape (cm) Cladode thickness (cm) Mean distance between areoles (cm) Average number of spines per areole Mean length of the longest spine per areole (cm)
O. ficus indica Jamaât Riah Ofi-B2 36.80 +3.16 abcd 45.08 +1.92 abcdefghi 3.00 +2.16 cdef 26.63 +2.36 bcdefghijk 13.63 +2.41bc 0.51 + 0.09bcdef 0.83 + 0.22abc 2.70 + 0.36bcdefg – –
Jamaât Riah Ofi-B3 37.10 +2.68 abcd 47.13 +9.91 abcdefghi 2.75 +0.96 cdef 21.98 +5.54 defghijkl 10.93 +2.44 bcd 0.50 +0.06 bcdef 0.68 +0.21 abc 2.58 +0.15 cdefg – –
Jamaât Riah Ofi-C2 33.38 +8.84 abcd 37.93 +16.12 abcdefghi 3.00 +0.82 cdef 21.80 +0.98 defghijkl 13.10 +0.33 bc 0.59 +0.01 bcdef 0.98 +0.05 abc 2.90 +0.08 bcdefg – –
Jamaât Riah Ofi-C3 36.25 +9.81 abcd 37.00 +6.77 abcdefghi 1.75 +0.50 ef 24.88 +1.84 bcdefghijk 13.25 +1.56 bc 0.56 +0.02 bcdef 0.73 +0.13 abc 2.93 +0.50 bcdefg – –
Jamaât Riah Ofi-D1 29.50 +4.55 abcd 28.38 +5.76 fghi 2.50 +0.58 cdef 20.08 +1.05 efghijkl 11.35 +0.29 bcd 0.57 +0.02 bcdef 1.10 +0.00 abc 2.45 +0.10 defg – –
Jamaât Riah Ofi-D2 30.13 +14.77 abcd 32.38 +14.51 cdefghi 2.00 +0.82def 28.90 +3.53 bcdef 13.19 +3.05 bc 0.47 +0.05 bcdef 1.20 +0.00 abc 2.68 +0.49 bcdefg – –
Jamaât Riah Ofi-D3 36.38 +3.42 abcd 51.38 +7.61 abcdefghi 3.75 +0.50bcdef 26.63 +3.38 bcdefghijk 13.85 +1.64 bc 0.52 +0.03 bcdef 0.90 +0.47 abc 2.68 +0.31 bcdefg – –
Jamaât Riah Ofi-E1 37.10 +10.54 abcd 43.33 +4.19 abcdefghi 2.25 +1.50def 25.13 +2.78 bcdefghijk 13.30 +1.72 bc 0.62 +0.16bcde 0.80 +0.29 abc 3.05 +0.33 bcdefg – –
Jamaât Riah Ofi-E2 42.75 +4.86 abc 52.25 +25.16 abcdefghi 3.75 +1.89 bcdef 27.43 +1.92 bcdefghij 13.80 +0.68 bc 0.50 +0.05 bcdef 0.75 +0.41 abc 2.90 +0.29 bcdefg – –
Jamaât Riah Ofi-F1 27.45 +12.12 abcd 51.95 +32.28 abcdefghi 3.50 +1.73 bcdef 28.25 +3.77 bcdefg 14.28 +1.81 bc 0.49 +0.04 bcdef 0.75 +0.41 abc 3.75 +0.29 ab – –
Jamaât Riah Ofi-F2 37.25 +7.58 abcd 66.00 +12.93 abc 4.00 +1.15 bcdef 28.15 +4.60bcdefgh 14.25 +1.94 bc 0.51 +0.04 bcdef 0.78 +0.39 abc 3.18 +0.62 bcdefg – –
Jamaât Riah Ofi-F3 31.88 +1.89 abcd 34.00 +5.58 cdefghi 2.25 +0.50def 22.10 +2.68 defghijkl 12.50 +0.71 bcd 0.55 +0.05 bcdef 0.60 +0.18 abc 2.78 +0.26 bcdefg – –
Jamaât Riah Ofi-G1 41.25 +14.31 abcd 37.28 +25.85 abcdefghi 3.50 +2.08 bcdef 27.55 +0.90 bcdefghij 10.13 +2.25cd 0.41 +0.08def 1.05 +0.12 abc 3.05 +0.29 bcdefg – –
Jamaât Riah Ofi-G2 32.63 +1.70 abcd 30.13 +4.01 cdefghi 1.50 +0.58 ef 23.75 +3.77 cdefghijkl 13.15 +2.21 bc 0.55 +0.02 bcdef 0.63 +0.13 abc 2.80 +0.24 bcdefg – –
Jamaât Riah Ofi-H1 39.38 +6.63 abcd 39.68 +1.89 abcdefghi 2.50 +0.58 cdef 26.45 +4.79 bcdefghijk 13.73 +1.39 bc 0.52 +0.08 bcdef 0.98 +0.32 abc 3.10 +0.20 bcdefg – –
Jamaât Riah Ofi-H2 30.00 +7.67 abcd 35.75 +5.74 bcdefghi 1.50 +0.58 ef 24.00 +2.04 cdefghijk 12.85 +0.53 bc 0.53 +0.02 bcdef 1.10 +0.16 abc 2.65 +0.04 bcdefg – –
Jamaât Riah Ofi-H3 26.30 +6.53 abcd 37.25 +2.33 abcdefghi 2.00 +0.00def 21.60 +1.96 defghijkl 10.60 +1.55bcd 0.48 +0.03 bcdef 1.20 +0.08 abc 2.60 +0.24 cdefg – –
Jamaât Riah Ofi-I2 29.88 +1.03 abcd 29.00 +11.05 efghi 1.75 +0.96 ef 18.17 +6.18 ghijkl 11.60 +1.10 bcd 0.72 +0.25b 0.70 +0.24 abc 2.80 +0.43 bcdefg – –
Jamaât Riah Ofi-J1 30.93 +2.69 abcd 33.00 +8.77 cdefghi 2.50 +1.00 cdef 21.33 +1.43 defghijkl 10.43 +1.25cd 0.49 +0.04 bcdef 0.70 +0.22 abc 2.73 +0.19 bcdefg – –
Jamaât Riah Ofi-J2 24.90 +10.25 bcd 27.23 +11.98 fghi 3.00 +0.82 cdef 19.50 +0.41 fghijkl 10.50 +1.22cd 0.53 +0.05 bcdef 0.90 +0.08 abc 2.50 +0.41 defg – –
Jamaât Riah Ofi-J3 22.83 +4.28 cd 30.50 +3.67 cdefghi 2.75 +0.50cdef 18.83 +1.09 fghijkl 9.88 +2.29cd 0.53 +0.14 bcdef 0.98 +0.22 abc 2.55 +0.13 cdefg – –
Rhamna Ofi-113 35.00 +3.34 abcd 62.88 +15.93 abcdef 4.25 +1.50 bcdef 25.95 +3.09 bcdefghijk 13.33 +1.48 bc 0.51 +0.03 bcdef 0.75 +0.41 abc 2.75 +0.31 bcdefg – –
Rhamna Ofi-121 29.83 +2.17 abcd 46.75 +10.20 abcdefghi 6.25 +1.71ab 25.28 +3.05 bcdefghijk 12.58 +1.26 bcd 0.50 +0.02 bcdef 0.88 +0.43 abc 2.90 +0.22 bcdefg – –
Rhamna Ofi-141 25.50 +0.00 bcd 26.50 +3.27 ghi 1.00 +0.00f 16.30 +0.24 kl 9.50 +0.41cd 0.57 +0.05 bcdef 0.90 +0.08 abc 2.60 +0.16 cdefg – –
Rhamna Ofi-142 24.75 +6.50 bcd 28.03 +4.01 fghi 1.00 +0.00f 22.60 +1.96 cdefghijkl 12.85 +2.16 bc 0.56 +0.05 bcdef 1.15 +0.04 abc 2.65 +0.53 bcdefg – –
Rhamna Ofi-151 33.93 +3.99 abcd 45.45 +3.32 abcdefghi 2.25 +1.26def 26.70 +2.52 bcdefghijk 12.00 +1.36 bcd 0.45 +0.08 bcdef 0.78 +0.22 abc 3.00 +0.14 bcdefg – –
Rhamna Ofi-152 31.48 +5.12 abcd 29.93 +1.34 defghi 1.50 +0.58ef 24.50 +3.39 bcdefghijk 11.30 +2.43 bcd 0.45 +0.04 bcdef 0.80 +0.38 abc 2.83 +0.46 bcdefg – –
Rhamna Ofi-153 27.10 +8.23 abcd 32.78 +20.66 cdefghi 2.00 +0.82def 22.14 +3.60 defghijkl 11.29 +2.47 bcd 0.47 +0.05 bcdef 1.00 +0.24 abc 3.23 +0.66 bcdefg – –
Rhamna Ofi-161 26.28 +5.33 abcd 31.33 +4.49 cdefghi 1.25 +0.50f 20.43 +3.81 efghijkl 11.60 +2.05 bcd 0.57 +0.06 bcdef 0.78 +0.36 abc 2.78 +0.32 bcdefg – –
Rhamna Ofi-162 27.25 +2.30 abcd 43.05 +11.40 abcdefghi 2.50 +0.58cdef 22.37 +1.69 cdefghijkl 12.77 +0.38 bc 0.57 +0.03 bcdef 0.80 +0.28 abc 2.80 +0.14 bcdefg – –
Rhamna Ofi-163 42.13 +5.39 abcd 71.38 +5.02 a 4.75 +1.89bcde 29.13 +4.21 bcdef 14.53 +1.75 bc 0.50 +0.05 bcdef 0.88 +0.17 abc 2.85 +0.87 bcdefg – –
Rhamna Ofi-1101 38.00 +4.32 abcd 36.50 +7.08 bcdefghi 2.25 +0.50def 27.70 +2.95 bcdefghi 13.48 +1.19 bc 0.49 +0.04 bcdef 0.95 +0.33 abc 3.00 +0.56 bcdefg – –
Ouardigha Ofi-211 25.38 +9.62 bcd 24.98 +9.72 ghi 1.00 +0.00f 22.25 +1.02 defghijkl 12.00 +0.00 bcd 0.54 +0.02 bcdef 1.15 +0.12 abc 2.40 +0.08 efg – –
Ouardigha Ofi-212 26.63 +3.68 abcd 36.00 +6.16 bcdefghi 1.50 +0.58 ef 24.40 +2.57 bcdefghijk 12.17 +1.03 bcd 0.50 +0.05 bcdef 1.13 +0.17 abc 2.93 +0.45 bcdefg – –
Ouardigha Ofi-231 29.60 +3.93 abcd 42.13 +12.68 abcdefghi 2.50 +0.58 cdef 21.10 +4.66 defghijkl 11.05 +3.14 bcd 0.52 +0.04 bcdef 0.58 +0.21 abc 2.53 +0.62 defg – –
Ouardigha Ofi-232 28.25 +3.97 abcd 31.00 +4.32 cdefghi 2.00 +0.82def 18.00 +1.63 ghijkl 10.30 +0.24cd 0.57 +0.06 bcdef 0.70 +0.16 abc 2.80 +0.16 bcdefg – –
Ouardigha Ofi-233 24.13 +9.08 bcd 29.00 +5.55 efghi 1.75 +0.96 ef 18.57 +1.41 fghijkl 9.10 +0.65cd 0.49 +0.02 bcdef 0.73 +0.12 abc 2.57 +0.49 cdefg – –
Ouardigha Ofi-261 22.30 +3.19 cd 29.45 +6.44 defghi 1.00 +0.00f 19.60 +3.59 fghijkl 10.65 +1.67 bcd 0.54 +0.02 bcdef 0.85 +0.12 abc 2.70 +0.16 bcdefg – –
Ouardigha Ofi-262 26.70 +3.85 abcd 35.63 +4.17 bcdefghi 1.50 +0.58 ef 22.81 +3.35 cdefghijkl 11.43 +0.52 bcd 0.49 +0.03 bcdef 0.97 +0.34 abc 2.73 +0.21 bcdefg – –
Ouardigha Ofi-263 39.13 +4.21 abcd 44.60 +4.33 abcdefghi 1.75 +0.50 ef 30.45 +1.56abcde 13.50 +0.71 bc 0.50 +0.12 bcdef 0.93 +0.46 abc 3.15 +0.24 bcdefg – –
Ouardigha Ofi-264 28.33 + 4.44 abcd 36.88 + 9.19 abcdefghi 2.50 +1.00 cdef 23.90 +1.34 cdefghijk 11.27 +0.56 bcd 0.47 +0.03 bcdef 0.47+0.10 c 2.40 + 0.26 efg – –
Ouardigha Ofi-265 24.25 +0.61 bcd 35.25 +5.92 bcdefghi 3.00 +0.82 cdef 23.20 +0.16 cdefghijkl 10.20 +0.16cd 0.43 +0.08cdef 1.10 +0.08 abc 2.90 +0.73 bcdefg – –
Ouardigha Ofi-266 29.88 + 5.02 abcd 27.75 +1.32 fghi 1.50 +0.58 ef 27.23 +6.65 bcdefghij 13.77 +1.45 bc 0.52 +0.06 bcdef 0.77 +0.09 abc 3.33 +0.24bcdef – –
Ouardigha Ofi-271 27.17 +7.71 abcd 28.83 +8.66 efghi 1.50 +0.58 ef 26.20 +0.82 bcdefghijk 12.45 +0.37 bcd 0.47 +0.00 bcdef 1.05 +0.04 abc 3.00 +0.00 bcdefg – –
Ouardigha Ofi-272 35.88 +11.35 abcd 30.75 +8.07 cdefghi 2.00 +0.82def 22.48 +3.26 cdefghijkl 12.18 +0.96 bcd 0.54 +0.06 bcdef 1.03 +0.10 abc 2.68 +0.28 bcdefg – –
Ouardigha Ofi-273 24.33 +5.09 bcd 27.38 +12.15 fghi 1.50 +0.58 ef 17.53 +2.50 hijkl 9.87 +0.26cd 0.57 +0.10 bcdef 0.63 +0.05 abc 2.47 +0.39 defg – –
Ouardigha Ofi-274 28.38 +6.80 abcd 35.00 +9.70 bcdefghi 2.00 +0.82def 19.73 +6.88 fghijkl 10.25 +1.19cd 0.56 +0.18 bcdef 0.73 +0.10 abc 2.43 +0.40 efg – –
Ouardigha Ofi-275 21.55 + 8.86 cd 16.43 +3.51 i 1.50 +0.58 ef 18.55 +3.23 fghijkl 12.30 +0.90 bcd 0.67 +0.07bcd 1.15 +0.04 abc 2.70 +0.24 bcdefg – –
Middle atlas Ofi-311 35.68 +7.92 abcd 50.88 +3.45 abcdefghi 2.25 +0.50def 24.15 +6.68 bcdefghijk 11.65 +1.08 bcd 0.50 +0.08 bcdef 0.65 +0.10 abc 2.53 +0.10 defg – –
Middle atlas Ofi-321 38.50 +19.07 abcd 29.13 +12.80 efghi 3.75 +0.96 bcdef 23.47 +2.17 cdefghijkl 12.87 +1.62 bc 0.54 +0.03 bcdef 0.70 +0.14 abc 3.20 +0.14 bcdefg – –
Middle atlas Ofi-331 31.88 +8.23 abcd 22.25 +1.66 ghi 1.00 +0.00f 13.70 +0.00 l 10.70 +0.00 bcd 0.65 +0.11 bcd 0.80 +0.00 abc 2.55 +0.04 cdefg – –
Middle atlas Ofi-341 30.63 +6.94 abcd 31.38 +7.06 cdefghi 1.50 +0.58 ef 19.27 +6.73 fghijkl 13.00 +0.50 bc 0.51 +0.05 bcdef 0.83 +0.17 abc 3.13 +0.26 bcdefg – –
Middle atlas Ofi-351 31.00 +8.13 abcd 30.13 +10.01 cdefghi 1.75 +0.50 ef 21.07 +2.08 defghijkl 11.93 +0.99 bcd 0.56 +0.01 bcdef 0.77 +0.29 abc 3.03 +0.48 bcdefg – –
Northeast Morocco Ofi-421 31.00 +7.43 abcd 32.68 +9.46 cdefghi 1.50 +0.58 ef 23.48 +1.07 cdefghijkl 11.53 +1.02 bcd 0.52 +0.06 bcdef 0.73 +0.21 abc 2.45 +0.26defg – –
Northeast Morocco Ofi-451 24.50 +1.78 bcd 39.63 +12.96 abcdefghi 2.50 +0.58 cdef 23.60 +1.31 cdefghijkl 11.30 +0.41 bcd 0.47 +0.01 bcdef 0.70 +0.00 abc 2.40 +0.08 efg – –
Eastern Rif Ofi-521 21.88 +6.51 cd 21.50 +10.01 hi 1.00 +0.00f 17.00 +1.63 jkl 12.00 +1.63 bcd 0.70 +0.16 bc 1.10 +0.08 abc 3.50 +0.41 abcde – –
Eastern Rif Ofi-531 21.33 +6.55 cd 23.33 +7.32 ghi 1.00 +0.00f 22.50 +0.41 cdefghijkl 12.00 +1.63 bcd 0.53 +0.02 bcdef 1.00 +0.16 abc 2.60 +0.33 cdefg – –
Eastern Rif Ofi-533 32.40 +14.02 abcd 42.30 +23.93 abcdefghi 3.75 +2.36 bcdef 26.93 +1.37 bcdefghij 12.90 +0.51 bc 0.48 +0.04 bcdef 0.73 +0.21 abc 4.17 +1.31a – –
Eastern Rif Ofi-542 26.38 +15.21 abcd 29.75 +21.63 defghi 2.00 +0.82def 29.05 +1.02 bcdef 14.85 +0.78 bc 0.51 +0.01 bcdef 0.85 +0.04 abc 3.70 +0.08abc – –
Eastern Rif Ofi-561 37.25 +5.84 abcd 34.93 +14.14 bcdefghi 1.75 +0.96 ef 26.20 +6.49 bcdefghijk 12.75 +3.52 bc 0.48 +0.05 bcdef 0.78 +0.30 abc 2.70 +0.48 bcdefg – –
Western Rif Ofi-612 36.25 +8.87 abcd 33.63 +9.32 cdefghi 2.75 +0.50 cdef 23.10 +2.21 cdefghijkl 11.57 +1.05 bcd 0.50 +0.03 bcdef 1.03 +0.09 abc 2.37 +0.45 efg – –
Western Rif Ofi-631 30.20 +9.41 abcd 33.88 +13.14 cdefghi 3.50 +0.58 bcdef 21.00 + 0.41 defghijkl 12.25 +0.20 bcd 0.58 +0.00 bcdef 0.75 +0.04 abc 2.80 +0.00 bcdefg – –
Agadir Ofi-711 41.70 +5.77 abcd 50.80 +9.72 abcdefghi 2.75 +1.26 cdef 28.38 +2.84 bcdefg 12.90 +2.37 bc 0.49 +0.15 bcdef 0.55 +0.19bc 3.03 +0.90 bcdefg – –
Agadir Ofi-712 40.17 +6.54 abcd 57.50 +20.00 abcdefgh 4.25 +2.63 bcdef 26.03 +2.53 bcdefghijk 15.47 +2.17 bc 0.56 +0.04 bcdef 0.87 +0.17 abc 2.70 +0.22 bcdefg – –
Agadir Ofi-713 45.43 +4.64 ab 38.75 +8.21 abcdefghi 2.25 +1.26def 34.00 +3.58ab 20.23 +10.73a 0.58 +0.25 bcdef 0.83 +0.26 abc 3.00 +0.08 bcdefg – –
Agadir Ofi-714 35.78 +6.63 abcd 47.43 +8.25 abcdefghi 2.50 +0.58 cdef 25.15 +9.11 bcdefghijk 15.78 +3.26 bc 0.67 +0.21 bcd 0.86 + 0.21 abc 2.85 +0.24 bcdefg – –
Agadir Ofi-723 39.03+11.53 abcd 43.88 +15.29 abcdefghi 2.25 +0.96def 28.45 +2.19 bcdefg 15.08 +0.87 bc 0.53 +0.04 bcdef 1.00 +0.16 abc 3.05 +0.10 bcdefg – –
Agadir Ofi-731 36.85 +4.98 abcd 48.38 +7.62 abcdefghi 2.00 +0.82def 27.43 +1.54 bcdefghij 14.13 +1.26 bc 0.51 +0.03 bcdef 0.88 +0.28 abc 2.95 +0.54 bcdefg – –
Agadir Ofi-732 42.68 +8.01 abc 40.58 +8.39 abcdefghi 2.50 +0.58 cdef 29.00 +3.24 bcdef 14.80 +0.99 bc 0.51 +0.03 bcdef 1.10 +0.22 abc 3.13 +0.25 bcdefg – –
Agadir Ofi-733 38.25 + 10.44 abcd 42.65 +16.01 abcdefghi 2.25 +0.50def 27.65 +8.00 bcdefghi 13.48 +2.67 bc 0.48 +0.05 bcdef 1.13 +0.56 abc 3.00 +0.28 bcdefg – –
Agadir Ofi-742 42.93 +9.94 abc 56.25 +23.09 abcdefgh 3.75 +1.71 bcdef 27.00 +2.27 bcdefghij 13.33 +1.68 bc 0.49 +0.07 bcdef 0.75 +0.24 abc 2.98 +0.24 bcdefg – –
Agadir Ofi-743 39.75 +10.43 abcd 69.88 +26.42 ab 4.25 +3.30 bcdef 25.98 +4.29 bcdefghijk 12.95 +1.32 bc 0.50 +0.06 bcdef 0.63 +0.29 abc 3.03 +0.40 bcdefg – –
Agadir Ofi-751 45.75 +2.72 ab 50.88 +19.84 abcdefghi 4.00 +1.63 bcdef 32.68 +10.79 abc 13.13 +1.11 bc 0.44 +0.18 cdef 1.00 +0.26 abc 3.05 +0.33 bcdefg – –
Agadir Ofi-752 46.18 +3.94 ab 64.63 +6.42 abcde 5.25 +0.50bcd 31.15 +2.56 abcd 15.63 +0.75 bc 0.50 +0.06 bcdef 0.73 +0.24 abc 2.88 +0.48 bcdefg – –
Agadir Ofi-761 40.00 +10.58 abcd 55.38 +19.74 abcdefgh 3.50 +1.29 bcdef 22.45 +6.94 cdefghijkl 13.43 +3.06 bc 0.63 +0.22bcde 0.73 +0.40 abc 2.68 +0.24 bcdefg – –
Agadir Ofi-762 48.25 + 5.12 a 45.00 +13.20 abcdefghi 3.00 +1.41 cdef 23.65 +3.49 cdefghijkl 13.25 +1.46 bc 0.56 +0.08 bcdef 0.88 +0.34 abc 2.68 +0.30 bcdefg – –
Agadir Ofi-771 33.38 +3.25 abcd 46.00 +5.07 abcdefghi 3.00 +1.41 cdef 25.83 +1.72 bcdefghijk 12.05 +1.46 bcd 0.46 +0.05 bcdef 0.90 +0.16 abc 2.75 +0.65 bcdefg – –
Agadir Ofi-772 33.93 +3.00 abcd 47.07 +12.40 abcdefghi 2.00 +0.82def 25.73 +1.46 bcdefghijk 12.80 +1.12 bc 0.49 +0.05 bcdef 0.73 +0.25 abc 2.63 +0.19 bcdefg – –
O. megacantha Jamaât Riah Om-A1 30.43 +3.54 abcd 42.05 +15.92 abcdefghi 2.75 +0.96 cdef 25.38 +3.50 bcdefghijk 12.38 +0.48 bcd 0.49 +0.07 bcdef 0.80 +0.18 abc 2.68 +0.39 bcdefg 4.25 + 1.50 abc 2.70 + 0.22ghijklmno
Jamaât Riah Om-A2 32.15 + 2.83 abcd 43.05 +13.93 abcdefghi 2.00 +0.00def 25.15 +1.65 bcdefghijk 14.67 +1.31 bc 0.58 +0.03 bcdef 0.90 +0.16 abc 2.90 +0.16 bcdefg 3.75 +0.50cd 3.00 +0.50 cdefghijklm
Jamaât Riah Om-A3 29.03 +5.85 abcd 36.60 +6.13 bcdefghi 2.75 +0.96 cdef 25.40 +1.55 bcdefghijk 12.80 +0.98 bc 0.50 +0.01 bcdef 1.05 +0.04 abc 3.10 +0.33 bcdefg 3.00 +0.00d 2.15 +0.29 nop
Jamaât Riah Om-B1 29.03 +5.85 abcd 36.60 +6.13 bcdefghi 1.75 +0.50 ef 25.25 +1.56 bcdefghijk 12.35 +1.11 bcd 0.49 +0.02 bcdef 0.98 +0.10 abc 2.95 + 0.37 bcdefg 3.00 + 0.00d 2.38 +0.39 jklmno
Jamaât Riah Om-K1 25.00 +10.39 bcd 21.65 +12.88 hi 1.00 +0.00f 23.53 +0.38 cdefghijkl 13.00 +1.63 bc 0.55 +0.04 bcdef 1.30 +0.08 abc 3.00+0.41 bcdefg 4.00 +0.82 bcd 2.10 +0.08 op
Jamaât Riah Om-K2 33.93 +9.72 abcd 41.88 +10.36 abcdefghi 3.50 +1.00 bcdef 26.30 +3.50 bcdefghijk 12.83 +2.42 bc 0.48 +0.03ef 1.40+1.33a 2.90 +0.36 bcdefg 3.00 +0.82 d 3.07 +0.51 cdefghijk
Jamaât Riah Om-K3 32.63 +7.87 abcd 65.38 +14.10 abcd 4.25 +0.96 bcdef 26.28 +1.21 bcdefghijk 14.05 +1.17 bc 0.53 +0.03 bcdef 0.68 +0.33 abc 3.05 +0.17 bcdefg 3.50 +0.58 cd 2.60 +0.66hijklmno
Rhamna Om-111 29.50 + 3.27 abcd 50.05 +3.23 abcdefghi 2.50 +0.58 cdef 24.85 +1.51 bcdefghijk 11.00 +0.00 bcd 0.44 +0.02 cdef 0.60 +0.00 abc 2.85 +0.12 bcdefg 4.00 +0.00bcd 2.70 +0.00ghijklmno
Rhamna Om-112 26.38 +2.06 abcd 30.13 +7.88 cdefghi 1.50 +0.58 ef 19.83 +4.19 fghijkl 9.40 +1.04cd 0.48 +0.06 bcdef 0.53 +0.05c 2.67 +0.47 bcdefg 3.00 +0.00 d 2.27 +0.12 mnop
Rhamna Om-122 28.90 +5.32 abcd 42.58 +8.63 abcdefghi 3.00 +1.41 cdef 23.17 +2.05 cdefghijkl 14.33 +3.52 bc 0.51 +0.01 bcdef 0.80 +0.33 abc 2.70 +0.50 bcdefg 3.00 +0.00 d 2.77 +0.46ghijklmno
Rhamna Om-131 37.75 +3.88 abcd 55.38 +20.27 abcdefgh 3.75 +2.36 bcdef 23.75 +4.17 cdefghijkl 13.30 +2.03 bc 0.56 +0.03 bcdef 1.00 +0.47 abc 3.03 +0.67 bcdefg 4.00 +0.00 bcd 3.80 +0.58 ab
Rhamna Om-143 24.67 +0.62 bcd 34.07 +3.35 cdefghi 2.50 +1.73 cdef 22.70 +3.84 cdefghijkl 9.75 +0.20cd 0.45 +0.09 bcdef 0.70 +0.16 abc 2.55 +0.04 cdefg 3.50 +0.58 cd 2.30 +0.08 lmnop
Rhamna Om-181 27.28 +4.30 abcd 32.88 +5.42 cdefghi 1.00 +0.00f 37.00 +1.63a 12.50 +0.41 bcd 0.33 +0.02f 0.90 +0.08 abc 3.00 +0.08 bcdefg 4.00 +0.82 bcd 1.70 +0.16 p
Ouardigha Om-221 25.13 +8.13 bcd 39.25 +7.71 abcdefghi 2.00 +0.82def 20.63 +1.25 defghijkl 10.88 +0.75 bcd 0.52 +0.03 bcdef 0.75 +0.26 abc 2.38 +0.15 efg 3.50 +0.58 cd 2.98 +0.66defghijklm
Ouardigha Om-251 29.03 + 4.45 abcd 37.75 +11.26 abcdefghi 2.50 +0.58 cdef 21.70 +0.73 defghijkl 12.50 +0.82 bcd 0.57 +0.02 bcdef 1.00 +0.08 abc 3.00 +0.00 bcdefg 3.00 +0.00 d 2.30 +0.00 lmnop
Middle atlas Om-267 31.63 +2.17 abcd 43.38 +8.36 abcdefghi 2.75 +2.36 cdef 20.93 +2.81 defghijkl 11.15 +1.35 bcd 0.53 +0.04 bcdef 0.70 +0.18 abc 2.60 + 0.34cdefg 3.50 +1.00 cd 2.75 +0.80ghijklmno
Middle atlas Om-352 31.88 +6.76 abcd 42.15 +13.78 abcdefghi 2.75 +0.50 cdef 22.83 +2.25 cdefghijkl 12.70 +0.92 bc 0.55 +0.02 bcdef 0.77 +0.26 abc 2.90 +0.43 bcdefg 3.50 +1.00 cd 2.83 +0.40efghijklmn
Middle atlas Om-371 32.50 +6.54 abcd 42.38 +12.26 abcdefghi 2.25 +1.26def 25.50 +3.97 cdefghijkl 12.75 +1.85 bc 0.57 +0.18 bcdef 0.83 +0.15 abc 2.75 +0.33 bcdefg 5.00 +1.15a 3.08 +0.49 cdefghijk
Northeast Morocco Om-411 39.73 +8.94 abcd 58.50 +7.93 abcdefg 3.25 +0.50 cdef 25.30 +2.89 bcdefghijk 13.95 +2.42 bc 0.55 +0.05 bcdef 0.73 +0.24 abc 3.15 +0.83 bcdefg 4.25 +0.50 abc 3.13 +0.57 cdefghi
Northeast Morocco Om-422 30.63 +2.02 abcd 44.63 +7.38 abcdefghi 2.50 +1.73cdef 22.88 +1.11 cdefghijkl 11.85 +2.28 bcd 0.52 +0.07 bcdef 0.80 +0.32 abc 2.73 +0.25 bcdefg 3.75 +0.50 cd 3.35 +0.13bcdefg
Northeast Morocco Om-431 38.85 +7.35 abcd 40.95 +19.31 abcdefghi 3.00 +0.82 cdef 23.67 +1.43 cdefghijkl 13.23 +0.76 bc 0.55 +0.03 bcdef 0.80 +0.22 abc 2.75 +0.21 bcdefg 4.50 +0.58 abc 3.57 +0.39 abcd
Northeast Morocco Om-441 36.63 + 7.23 abcd 43.35 +10.61 abcdefghi 1.75 +0.96 ef 26.25 +4.52 bcdefghijk 12.97 +0.54 bc 0.47 +0.06 bcdef 1.20 +0.85 abc 2.63 +0.26 bcdefg 3.00 +0.00 d 2.97 +0.12defghijklm
Northeast Morocco Om-442 35.25 +3.57 abcd 54.50 +7.33 abcdefgh 2.00 +0.00def 26.43 +2.32 bcdefghijk 13.60 +0.90 bc 0.51 +0.01 bcdef 0.75 +0.21 abc 2.85 +0.39 bcdefg 3.75 +0.50 cd 3.28 +1.03 bcdefgh
Northeast Morocco Om-461 29.80 +12.09 abcd 34.15 +15.09 cdefghi 2.50 +0.58 cdef 22.55 +2.59 cdefghijkl 12.40 +1.73 bcd 0.54 +0.02 bcdef 0.87 +0.17 abc 2.43 +0.31 efg 3.50 +0.58 cd 2.53 +0.34 ijklmno
Northeast Morocco Om-471 35.00 +5.72 abcd 33.00 +8.16 cdefghi 1.00 +0.00f 23.75 +1.84 cdefghijkl 13.75 +1.02 bc 0.57 +0.01 bcdef 0.85 +0.04 abc 3.05 +0.04 bcdefg 3.50 +0.58 cd 2.80 +0.08fghijklmno
Eastern Rif Om-511 28.13 +8.93 abcd 30.20 +10.41 cdefghi 3.50 +0.58 bcdef 24.25 +3.06 bcdefghijk 12.90 + 1.96 bc 0.52 +0.01 bcdef 1.10 +0.00 abc 2.50 +0.00 defg 4.00 +0.00 bcd 2.85 +0.53efghijklmn
Eastern Rif Om-532 36.50 +6.16 abcd 45.40 +20.76 abcdefghi 3.00 +1.15 cdef 20.98 +3.81 defghijkl 12.40 +2.09 bcd 0.59 + 0.05 bcdef 0.80 +0.20 abc 2.75 +0.21 bcdefg 4.00 +0.00 bcd 2.43 +0.22 ijklmno
Eastern Rif Om-541 37.38 +6.14 abcd 40.75 +15.02 abcdefghi 2.00 +0.82def 22.75 +3.84 cdefghijkl 12.38 +1.60 bcd 0.55 +0.06 bcdef 0.80 +0.29 abc 2.73 +0.46 bcdefg 3.50 +0.58 cd 2.43 +0.49 ijklmno
Eastern Rif Om-543 39.13 + 6.14 abcd 38.58 +9.14 abcdefghi 2.25 +0.50def 20.90 +2.31 defghijkl 11.03 +1.86 bcd 0.52 +0.06 bcdef 0.85 +0.13 abc 2.13 +0.25 g 3.75 +0.50 cd 2.88 +0.25efghijklmn
Eastern Rif Om-551 31.75 +5.39 abcd 44.50 +7.82 abcdefghi 2.50 +1.73 cdef 20.50 +4.02 efghijkl 13.85 +7.67 bc 0.70 +0.19bc 0.90 +0.16 abc 2.30 +0.38 fg 4.00 +0.00 bcd 2.35 +0.64 klmno
Eastern Rif Om-571 40.33 +5.37 abcd 35.50 +10.45 bcdefghi 2.50 +1.73 cdef 23.80 +2.03 cdefghijkl 13.23 +1.34 bc 0.55 +0.04 bcdef 0.95 +0.10 abc 2.33 +0.15 fg 4.25 +0.50 abc 2.40 +0.12 ijklmno
Eastern Rif Om-572 37.50 + 11.02 abcd 35.00 +4.49 bcdefghi 1.00 +0.00f 25.35 +4.20 bcdefghijk 13.85 +3.55 bc 0.53 +0.05 bcdef 1.05 +0.20 abc 2.30 +0.41 fg 3.50 +0.58 cd 2.30 +0.08 lmnop
Eastern Rif Om-581 35.63 +9.07 abcd 40.38 +7.80 abcdefghi 4.00 +1.83 bcdef 21.13 +1.18 defghijkl 11.40 +0.86 bcd 0.54 +0.03 bcdef 0.85 +0.06 abc 2.05 +0.31 g 4.25 +0.50 abc 2.85 +0.10efghijklmn
Western Rif Om-632 37.45 +4.59 abcd 30.68 +7.81 cdefghi 3.00 +0.82 cdef 17.30 +4.87 ijkl 11.50 +1.35 bcd 0.55 +0.06 bcdef 0.70 +0.20 abc 2.48 +0.13 defg 4.00 +0.00 bcd 2.30 +0.14 lmnop
Western Rif Om-621 29.00 +7.82 abcd 28.13 +7.20 fghi 2.50 +1.29 cdef 21.75 +0.20 defghijkl 11.00 +0.00 bcd 0.65 +0.12 bcd 0.90 +0.08 abc 2.35 +0.29 efg 3.50 +0.58 cd 2.35 +0.12 klmno
Western Rif Om-651 38.13 + 7.40 abcd 54.00 +6.87 abcdefgh 2.75 +0.50 cdef 22.93 +3.20 cdefghijkl 13.40 +2.09 bc 0.58 +0.02 bcdef 0.80 +0.22 abc 2.43 +0.38 efg 4.00 +0.00 bcd 2.95 +0.50defghijklm
Agadir Om-722 31.98 + 4.04 abcd 41.50 +8.50 abcdefghi 3.50 +0.58 bcdef 24.23 +1.93 bcdefghijk 12.56 +1.70 bcd 0.51 +0.03 bcdef 0.80 +0.24 abc 2.63 +0.26 bcdefg 4.00 +0.00 bcd 3.03 +0.05 cdefghijkl
Agadir Om-741 31.63 +3.12 abcd 57.43 +6.95 abcdefgh 3.75 +1.26 bcdef 23.75 +1.44 cdefghijkl 11.95 +1.14 bcd 0.50 +0.04 bcdef 0.85 +0.47 abc 2.08 +0.61 g 3.75 +0.50 cd 2.63 +0.62 hijklmno
O. robusta Northeast Morocco Or-412 29.28 +6.52 abcd 42.20 +6.37 abcdefghi 2.75 +0.96 cdef 17.90 +3.59 ghijkl 17.33 +3.45ab 0.97 +0.10a 1.38 +0.05ab 3.60 +0.45abcd 4.50 +0.58 abc 4.03 +0.05a
O. aequatorialis Rhamna Oa-171 39.88 +6.94 abcd 34.63 +4.70 cdefghi 3.25 +0.50 cdef 30.63 +2.95 abcde 14.03 +9.99 bc 0.48 +0.41 bcdef 1.08 +0.39 abc 2.43 +0.33 efg 5.00 +0.82 a 3.48 +0.32 abcdef
O. dillenii Ouardigha Od-242 19.85 +2.16 d 28.50 +3.67 efghi 7.75 +3.50a 13.75 +1.84l 6.25 +0.86d 0.45 +0.00 bcdef 0.65 +0.04 abc 2.90 +0.16 bcdefg – –
O. leucotricha Middle atlas Ol-361 37.63 +3.35 abcd 53.33 +9.51 abcdefgh 4.00 +0.82 bcdef 24.75 + 3.10 bcdefghijk 14.38 +0.25 bc 0.66 +0.19 bcd 1.13 +0.31 abc 2.70 +0.26 bcdefg 5.00 +0.82 a 3.85 +0.54 ab
Western Rif Ol-633 42.55 +9.17 abc 42.93 +18.69 abcdefghi 2.25 +1.26def 24.40 +5.63 bcdefghijk 13.18 +2.19 bc 0.55 +0.10 bcdef 0.93 +0.32 abc 2.90 +0.12 bcdefg 4.50 +1.29 abc 3.53 +1.01 abcde
Western Rif Ol-611 45.88 +1.11 ab 50.50 +6.81 abcdefghi 4.00 +1.63 bcdef 27.30 +3.50 bcdefghij 13.63 +1.49 bc 0.50 +0.02 bcdef 0.85 +0.24 abc 2.73 +0.38 bcdefg 4.25 +0.50 abc 3.65 +0.84 abc
Western Rif Ol-641 40.98 +8.04 abcd 51.95 +13.07 abcdefghi 3.25 +0.50 cdef 23.95 +5.17 cdefghijk 13.45 +2.09 bc 0.54 +0.03 bcdef 0.85 +0.24 abc 2.62 +0.26 bcdefg 4.75 +0.96 ab 3.10 +1.05 cdefghij
O. inermis Rhamna Oi-191 35.63 +8.94 abcd 50.00 +8.99 abcdefghi 5.75 +0.96bc 20.73 +3.26 defghijkl 9.60 +1.82cd 0.46 +0.02 bcdef 0.78 +0.28 abc 2.33 +0.25 fg – –

 

Figure 1 - Map of Morocco showing the geographic origin of the 124 accessions of Opuntia spp. used in this study. Figure 1: Map of Morocco showing the geographic origin of the 124 accessions of Opuntia spp. used in this study. 
Click here to View figure

 

Molecular Analysis

DNA Extraction

In this study, we used 22 ecotypes from different geographic origins in Morocco, and which represent seven species of Opuntia identified from the morphological traits; for example, for O. ficus indica, we used 8 accessions, each one was collected from a different region. Total genomic DNA was extracted according to the protocol of Doyle and Doyle (1990)17 with some slight modifications, using 1 g of lyophilized and ground cladode tissue. The DNA concentration was then diluted to 20 ng/µL with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8) using a biophotometer (Eppendorf).

ISSR Analysis

Fourteen ISSR primers (Table 2) purchased either from Operon Technologies Inc. (Alameda, CA, USA) or Qiagen (Valencia, CA, USA) were tested in this study; and 2.5 µL of each primer was added to a PCR mixture containing 3 µL DNA template, 12.3 µL sterile distilled water, 3.5 µL (25 mM) MgCl2, 1 µL(10 mM) dNTPs, 0.2 µL(5u/µL) Taq polymerase and 2.5 µL Taq buffer (All purchased from Promega, Madison, WI, USA). DNA amplifications were performed using a DNA thermal cycler (Techne) with the following parameters: initial denaturation at 94°C for 5 min, 45 cycles of 15 s of denaturation at 94 °C, 30 s of annealing at the specific temperature of each primer (Table 2), and 60 s of extension at 72°C; then a final extension at 72 °C for 7 min.

Table 2: List and characteristics of primers used to assess genetic variability within and among Opuntia spp in Morocco.

Primer type

Primer code Primer sequence 5’- 3’ Annealing temperature (°C) Total number of bands Number of polymorphic bands Sizerange(bp)

PIC

ISSR ISSR-8 ATCAATCAATCAATCA 30 7 7 234-1966 0.97
ISSR-17 ATCATCATCATCATC 54 4 4 225-1268 0.93
ISSR-29 TGTATGTATGTATGTATGTACG 54 6 6 258-731 0.62
ISSR-31 GACAGACAGACAGACAGACA 54 9 9 125-1047 0.90
ISSR-34 CCTGGGTTCC 71 7 7 920-2077 0.86
ISSR-38 GGTGGCGGGA 71 8 7 391-1275 0.80
ISSR-42 ATCATCATCATCATCATCATC 60 – – – –
ISSR-46 ATCATCATCATCATC 60 8 7 158-2127 0.84
ISSR-48 CATCAGAAGTGCGTTCGTAGG 60 3 3 400-900 0.78
ISSR-49 TGTGTGTGTGTGTGTGTGTG 60 – – – –
ISSR-50 AGGAGGAGGAGGAGGAGGAGGAGGTC 73 7 7 271-889 0.80
ISSR-51 TCCTCCTCCTCCTCCAG 60 – – – –
ISSR-53 TCTCTCTCTCTCTCTCTCTC 71 – – – –
ISSR-54 TCCTCCTCCTCCTCCG 52 7 7 191-1047 0.77
Total 14 66 64
Mean 6.6 6.4 0.82
RAPD UBC-515 GGGGGCCTCA 36 – – – –
UBC-518 TGCTGGTCCA 36 – – – –
UBC-523 ACAGGCAGAC 36 – – – –
UBC-528 GGATCTATGC 36 – – – –
UBC-529 CACTCCTACA 36 – – – –
UBC-531 GCTCACTGTT 36 – – – –
UBC-533 GCATCTACGC 36 – – – –
UBC-536 GCCCCTCGTC 36 – – – –
UBC-547 TATGACCTGG 36 – – – –
UBC-548 GTACATGGGC 36 – – – –
UBC-551 GGAAGTCCAC 36 – – – –
UBC-562 CAAAGTAGCC 36 – – – –
UBC-565 GGTCGATTTC 36 – – – –
UBC-566 CCACATGCGA 36 – – – –
UBC-567 AGACACCTGA 36 – – – –
UBC-568 ACCTGTTCTC 36 – – – –
UBC-569 CGAATTGCTG 36 – – – –
UBC-570 GGCCGCTAAT 36 – – – –
UBC-571 GCGCGGCACT 36 6 6 464-1375 0.76
UBC-572 TTCGACCATC 36 – – – –
UBC-573 CCCTAATCAG 36 – – – –
UBC-574 GCCAGACAAG 36 – – – –
UBC-577 GTCTGATGTG 36 – – – –
UBC-584 GCGGGCAGGA 36 – – – –
UBC-587 GCTACTAACC 36 – – – –
UBC-588 CAGAGGTTGG 36 – – – –
UBC-589 GACGGAGGTC 36 – – – –
UBC-591 TCCCTCGTGG 36 – – – –
UBC-592 GGGCGAGTGC 36 – – – –
UBC-593 CGAGCTTTGA 36 – – – –
UBC-596 CCCCTCGAAT 36 – – – –
UBC-598 ACGGGCGCTC 36 – – – –
UBC-599 CAAGAACCGC 36 – – – –
UBC-600 GAAGAACCGC 36 – – – –
Total 34 6 6
Mean 6 6 0.76

 

RAPD Analysis

For RAPD analysis, 34 RAPD primers (Table 2) purchased from The University of British Columbia (UBC; Vancouver, Canada) were tested. The PCR mixture was containing the same above-mentioned components for ISSR primers, but with substituting ISSR primers with 0.4 µM of each RAPD primer. Amplification conditions were as follows: initial denaturation at 94°C for 5 min followed by 30 cycles of denaturation at 94 °C for 60 s, annealing at 36 °C for 60 s, and extension at 72 °C for 90 s; with a final extension at 72 °C for 15 min.

ISSR and RAPD Gel Electrophoresis

After amplification, 5 µL bromophenol blue (Sigma, St. Louis, MO, USA) was added to each amplification product. Afterwards, 8 µL of each sample was electrophoresed at 90 V, 5 W for 1 h on 1.8 % agarose gel (Promega, Madison, WI, USA) in 100 mL TBE buffer (90 mL sterile distilled water, 10 mL TBE buffer 10X; Promega, Madison, WI, USA) supplemented with 6.6 µL ethidium bromide (Sigma, St. Louis, MO, USA). Molecular weight of the amplified bands was estimated by comparison with lambda DNA/EcoR I and Hind III markers (Promega, Madison, WI, USA) as standard. The samples were then visualized and photographed with a gel documentation system (Fisher Scientific).

Statistical Analysis of Molecular Data

For each gel, we recorded the presence (1) or absence (0) of bands in individual lanes; consequently, a binary data matrix was created. For each marker, we calculated the polymorphic information content (PIC) using the formula developed by Botstein et al. (1980) [7]: PIG = 1-Σnj=1pi2-2Σn1-i=1Σnj= i+1pi2pj2. where pi and pj are the frequencies of the ith and jth alleles and n is the total number of such alleles. The Dice’s coefficients were calculated and a dendrogram was generated based on the similarity matrix and the SAHN module using unweighted pair-group method of arithmetic analysis (UPGMA). Afterwards, a principal component analysis (PCA) was performed. All these analyses were conducted using NTSYSpc v 2.1 software.34

Results and Discussion

Morphological traits to assess genetic variability

 Genetic variability within Opuntia ficus indica

Our investigation showed that Opuntia ficus indica is present in all the studied areas. However, our results demonstrated clear differences among the 78 accessions with regard to morphological descriptors. For example, the plant height was ranging from 21.33 cm in Ofi-531 (from Eastern Rif) to 48.25 cm in Ofi-762 (from Agadir) and the plant diameter was ranging from 16.43 cm in Ofi-275 (from Ouardigha) to 71.38 in Ofi-163 (from Rhamna). In some cases, accessions from the same geographical site exhibited significantly different measures of morphological traits; for example, in accessions from Rhamna, cladode length was ranging from 16.30 cm in Ofi-141 to 29.13 cm in Ofi-163 (Table 1). The O. ficus indica accessions showed similarity coefficients ranging from 0.00 to 1.00 (proximity matrix not shown). The lowest similarity coefficient was noticed between accessions Ofi-212 and Ofi-262 from Ouardigha and between accessions Ofi-771 and Ofi-772 from Agadir while the highest similarity coefficient was observed between accessions Ofi-163 (from Rhamna) and Ofi-275 (from Ouardigha). In some cases, accessions from different regions show very low similarity coefficient (e.g. Ofi-C3 from Jamaât Riah and Ofi-561 from Eastern Rif displayed a similarity coefficient of 0.001). The dendrogram presented in Figure 2 suggested 3 major clusters. The first cluster contains 30 accessions (38.46 % of the total accessions); the second cluster contains 5 accessions (6.41 % of the total accessions) and the third cluster is comprised of 43 accessions (55.13% of the total accessions). Surprisingly, the three clusters contain accessions collected from different geographical sites.

Figure 2 - Dendrogram grouping 78 accessions of Opuntia ficus indica based on 10 morphological traits and Ward’s method. The red stars indicate accessions used for molecular analysis Figure 2: Dendrogram grouping 78 accessions of Opuntia ficus indica based on 10 morphological traits and Ward’s method. The red stars indicate accessions used for molecular analysis.
Click here to View figure

 

Genetic variability within Opuntia megacantha

The plant height of O. megacantha accessions ranged from 24.67 cm to 40.33 cm, plant diameter from 21.65 cm to 65.38 cm, the average number of cladodes per plant from 1.00 to 4.25, cladode height from 17.30 cm to 37.00 cm, cladode width from 9.40 cm to 14.67 cm, the index of cladode shape from 0.33 to 0.70, cladode thickness from 0.53 cm to 1.40 cm, the mean distance between areoles from 2.05 cm to 3.15 cm, the average number of spines per areole from 3.00 to 5.00 and the mean length of the longest spine per areole from 1.70 cm to 3.80 cm. Here again, some accessions from the same region displayed significantly different measures of morphological traits (Table 1). The range of similarity coefficients was from 0.00 to 1.00 (proximity matrix not shown). The lowest similarity was between Om-B1 and Om-A3, both from Jamaât Riah, while the highest similarity was between Om-K1 and Om-K3, from Jamaât Riah too. The dendrogram (Figure 3) shows 3 clusters, the first cluster consisted of 11 accessions (28.95 % of the total accessions); the second cluster contains 20 accessions (52.63 % of the total accessions) whereas the third cluster comprised 7 accessions (18.42 % of the total accessions). Interestingly, accessions collected from different regions could be found within the same cluster.

Figure 3 - Dendrogram grouping 38 accessions of Opuntia megacantha based on 10 morphological traits and Ward’s method. The red stars indicate accessions used for molecular analysis Figure 3: Dendrogram grouping 38 accessions of Opuntia megacantha based on 10 morphological traits and Ward’s method. The red stars indicate accessions used for molecular analysis.
Click here to View figure

 

Genetic variability among Opuntia spp

Taking into consideration all the studied accessions of Opuntia spp., the plant height ranged from 19.85 cm in Od-242 to 48.25 cm in Ofi-762, the average number of cladodes per plant from 1.00 to 7.75 in Od-242, with cladodes of different heights (from 13.70 in Ofi-331 to 37.00 in Om-181) and widths (from 6.25 cm in Od-242 to 20.23 in Ofi-713). Cladode thickness varied from 0.47 cm in Ofi-264 to 1.40 cm in Om-K2 (Table 1). Among the studied species, O. ficus indica, O. dillenii and O. inermis are spineless. The similarity coefficients were ranging from 0.00 to 1.00. The dendrogram shows three different clusters (Figure 4), and accessions from different species or geographic origins could be gathered into the same cluster. This shows that the clusters obtained do not fit with the species or geographical sites evaluated.

Figure 4 - Dendrogram grouping 124 accessions of Opuntia spp. based on 10 morphological traits and Ward’s method. The red stars indicate accessions used for molecular analysis Figure 4: Dendrogram grouping 124 accessions of Opuntia spp. based on 10 morphological traits and Ward’s method. The red stars indicate accessions used for molecular analysis.
Click here to View figure

 

Molecular markers to assess genetic diversity

After screening 14 ISSR and 34 RAPD primers, 10 ISSR and 1 RAPD primers. were selected for producing unambiguous, reproducible and intense bands. The ISSR primers generated a total of 66 bands, 64 (96.9 %) of which were polymorphic. The number of bands observed per locus varied from 4 to 9, with an average of 6.6. The RAPD primer (UBC-571) gave 6 bands, all polymorphic (Table 2). Based on the PIC values, the markers were highly informative. Indeed, the PIC values varied from 0.62 to 0.97, with an average of 0.82. The highest PIC value was observed in primer ISSR-8 while the lowest value was observed in primer ISSR-29 (Table 2). The dendrogram displayed 7 clusters at a similarity of 0.76 (Figure 5). O. inermis was separated from all the other species. The two accessions of O. leucotricha (Ol-361 and Ol-611) were placed into two different groups while accessions Or-412 (O. robusta) and Oa-171 (O. aequatorialis) were gathered into the same cluster.  Interestingly, 14 accessions belonging to O. ficus indica and O. megacantha were gathered into the same group. This was confirmed by PCA (Figure 6), which results were similar to those obtained by the dendrogram.

Figure 5 - Dendrogram grouping 22 accessions of Opuntia spp. based on 10 ISSR and 1 RAPD markers Figure 5: Dendrogram grouping 22 accessions of Opuntia spp. based on 10 ISSR and 1 RAPD markers.
Click here to View figure

 

Figure 6 - 3D graphical distribution based on principal components analysis (PCA) showing the distribution of the 22 Opuntia spp. accessions Figure 6: 3D graphical distribution based on principal components analysis (PCA) showing the distribution of the 22 Opuntia spp. accessions.
Click here to View figure

 

Discussion

In the present study, the genetic diversity of 124 accessions of Opuntia spp. was evaluated based on 10 morphological descriptors. The use of morphological descriptors to determine genetic diversity within plant populations is simple, rapid and inexpensive.9 Thus, such descriptors were used in many plant species such as date palm,19 hexaploid oat16 and indigenous rice.43 To the best of our knowledge, this is the first work to assess genetic variability within and among Opuntia populations in Morocco using morphological descriptors. Studies on the genetic variability in Opuntia species using morphological descriptors are scarce. Peña-Valdivia et al. (2008)31 assessed genetic diversity within 55 accessions of Opuntia spp. in Mexico based on 65 morphological descriptors; and indicated that only few morphological traits showed significantly different measures within the studied populations. In a more recent study, Helsen et al. (2009)25 highlighted a clear differentiation between Opuntia species using descriptors based on fruit, flower, seed, spine and trunk characteristics. In our case, the 124 accessions showed significant differences in the measured parameters and were distributed into 3 main distinct clusters based on Ward’s method, containing 56, 45 and 23 accessions, respectively. Interestingly, accessions classified in the same species could be located in different clusters and vice versa, even though some species contain spines while others do not. This may be explained by several factors including the environmental effect and evolutionary change.11-40 Our results are in good agreement with Valadez-Moctezuma et al. (2014)39 who supported the hypothesis about the existence of a smaller number of Opuntia species compared to those currently described, but with high intraspecific genetic variation; and with Labra et al. (2003)27 who suggested that the presence of spines should not be considered as a parameter in Opuntia taxonomy. Our results showed the influence of geographical origins on the morphological traits within the same species. Indeed, in some cases, accessions of the same species but from different regions were gathered into different clusters. This might be due to the environment effect.37-38 Our results confirm previous findings on Opuntia spp. in Sardinia and Corsica islands, which show that environmental factors such as elevation, soil drainage, temperature and rainfall affect plant morphology.21 As far as Opuntia ficus indica is concerned, the use of morphological or agro-morphological traits to assess genetic diversity within its accessions is very scarce. Felker et al. (2005)22 compared genotypes of O. ficus indica from different origins based on yield and fruit characters, and significant differences were observed. In another investigation, Bendhifi et al. (2013)6 compared 28 Tunisian accessions of O. ficus indica using 20 descriptors based on plant, cladode and fruit characteristics. Here again, significant differences were observed between accessions. In our case, the 10 morphological traits showed significant differences between the 78 accessions. Remarkably, some accessions from the same geographical origin displayed significantly different measures of some traits. The use of morphological markers to assess genetic diversity within populations is simple and inexpensive. However, such markers can be affected by the environment.3 Therefore, in the recent years, molecular markers have been widely used to assess genetic diversity within plant populations. Indeed, it was reported that molecular markers cover a larger proportion of the genome than the morphological ones and are less influenced by the environment since genetic variability is evaluated based on genotype rather than phenotype.26-38 In addition, molecular markers have been proven powerful to detect variability when it could not be possible with morphological markers; i.e. a given morphological marker can affect other traits and the usefulness of morphological markers is restricted by their limited number.3 Along this line, molecular markers have been applied alone or in association with morphological descriptors to assess genetic variability in many plant species; e.g. in Phoenix dactylifera L. ,35 Olea europaea L.,8 Citrus sinensis L.29 Concerning the cactus pear, Labra et al. (2003)27 evaluated the genetic diversity among 11 Opuntia species from Italy using chloroplastic simple sequence repeat (cpSSR) and amplified fragment length polymorphism (AFLP) markers, and a high genetic similarity between O. ficus indica and O. megacantha was revealed. Indeed, these authors suggested that O. ficus indica should be considered as a domesticated form of O. megacantha. Caruso et al. (2010)10 assessed the genetic diversity among 62 accessions belonging to 16 Opuntia species from different origins, using simple sequence repeat (SSR) primers, and found that the O. ficus indica accessions did not cluster separately from some Opuntia species, including O. megacantha. In a more recent study, Valadez-Moctezuma et al. (2014)39 assessed the genetic variability among 12 Mexican Opuntia species (52 cultivars) with ISSR and RAPD markers, and reported that O. ficus indica and O. megacantha might have a common ancestry. Our results are consistent with all these authors, since a high genetic similarity was observed between O. ficus indica and O. megacantha. On the other hand, Valadez-Moctezuma et al. (2014)39 screened 120 RAPD primers, of which five were able to generate bands (4.16 %). In our case, only one RAPD primer over 34 (2.94 %) generated bands. Our findings indicated that ISSR markers are the most efficient and informative in Opuntia species. Recently, ISSR markers have been used to assess the genetic and phylogenetic relationships of 15 Opuntia species from Argentina, Bolivia, Brazil, Paraguay, and Uruguay.33 Our findings are in contrast with those of Valadez-Moctezuma et al. (2014),39 who indicated that the assessment of genetic diversity with RAPD markers was relatively more effective than with ISSR markers.  In our study, the total number of polymorphic bands (64) and the PIC values (0.62-0.97) of ISSR markers were different from those found by Valadez-Moctezuma et al. (2014),39 in which the number of polymorphic bands was 70 and the PIC varied from 0.21 to 0.27. This difference in polymorphic bands number and PIC values could be explained by the different ISSR primers employed (different sequences), the difference among accessions and the high distance between the geographical sites (Mexico and Morocco). Regarding the species Opuntia ficus indica, Zoghlami et al. (2007)44 used 8 RAPD primers (over 22 screened) to assess the genetic variability within 36 Tunisian accessions, and a considerable genetic diversity was detected. In Morocco, the genetic diversity within O. ficus indica accessions was evaluated using RAPD markers,18 and the effect of the geographical origin was revealed. In our case, findings showed high genetic similarity among the studied accessions of O. ficus indica, even though they were collected from different regions of Morocco.

Conclusion

This paper is the first report to assess the genetic diversity within and among Opuntia species in Morocco using morphological descriptors and molecular markers. A low level of genetic diversity was observed among the accessions analyzed and a high similarity between O. ficus indica and O. megacantha accessions was highlighted. Our findings show also that ISSR markers are very efficient and informative in Opuntia species. Our results should be taken into consideration for plant breeding and genetic resource conservation programs. Further investigations are currently underway in order to determine the biochemical characteristics of cladode, flower, fruit and juice of these species, and to specify their molecular families to highlight the most appropriate use of each species.

Acknowledgements

We are thankful to Mr. Alfeddy Mohamed Najib (INRA, Marrakech) for providing us with the DNA thermal cycler.

References

  1. Abdel-Hameed E. S, Nagaty M. A, Salman M. S, Bazaid S. A. Phytochemicals, nutritionals and antioxidant properties of two prickly pear cactus cultivars (Opuntia ficus indica Mill.) growing in Taif, KSA. Food Chem; 16: 031–38: (2014)
  2. Alauddin M, Quiggin J. Agricultural intensification, irrigation and the environment in South Asia: Issues and policy options. Ecol Econ; 65: 111–124: (2008)
    CrossRef
  3. Andersen J. R, Lübberstedt T. Functional markers in plants. Trends Plant Sci; 8554-560: (2003)
    CrossRef
  4. Andrade-Montemayor H. M, Cordova-Torres A. V, García-Gasca T, Kawas J. R. Alternative foods for small ruminants in semiarid zones, the case of Mesquite (Prosopis laevigata spp.) and Nopal (Opuntia spp.). Small Rumin Res; 98: 83–92: (2011)
    CrossRef
  5. Arba M. Le cactus Opuntia, une espèce fruitière et fourragère pour une agriculture durable au Maroc. Symposium international agriculture durable en région méditerranéenne (AGDUMED), Rabat, Morocco; 215-223: (2009)
  6. Bendhifi M, Baraket G, Zourgui L, Souid S, Salhi-Hannachi A. Assessment of genetic diversity of Tunisian Barbary fig (Opuntia ficus indica) cultivars by RAPD markers and morphological traits. Sci Hortic; 158: 1-7: (2013)
    CrossRef
  7. Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Gen; 32: 314–331: (1980)
  8. Brake M, Migdadi H, Al-Gharaibeh M, Ayoub S, Haddad N, El Oqlah A. Characterization of Jordanian olive cultivars (Olea europaea L.) using RAPD and ISSR molecular markers. Sci Hortic; 176: 282-289: (2014)
    CrossRef
  9. Bretting P. K, Widrlechner M. P. Genetic markers and horticultural germplasm management. Hortic Sci; 30: 1349-1356: (1995)
  10. Caruso M, Curro S, Las Casas G, La Malfa S, Gentile A. Microsatellite markers help to assess genetic diversity among Opuntia ficus indica cultivated genotypes and their relation with related species. Plant Syst Evol; 290: 85–97: (2010)
    CrossRef
  11. Chapman B, Mondragón-Jacobo C, Bunch R. A, Paterson H. Breeding and Biotechnology. In: Nobel PS (ed) Cacti: Biology and Uses. University of California Press, California, USA; 255-271: (2002)
    CrossRef
  12. Charcosset A, Moreau L. Use of molecular markers for the development of new cultivars and the evaluation of genetic diversity. Euphytica; 137: 81–94: (2004)
    CrossRef
  13. Costa R. G, Treviño I. H, de Medeiros G. R, Medeiros A. N, Pinto T. F, de Oliveira R. L. Effects of replacing corn with cactus pear (Opuntia ficus indica Mill) on the performance of Santa Inês lambs. Small Rumin Res; 102: 13–17:(2012)
    CrossRef
  14. Demey J. R, Zambrano A. Y, Fuenmayor F, Segovia V. Relación entre caracterizaciones molecular y morfológica en una colección de yuca. Interciencia; 28: 684–689: (2003)
  15. Dereje M, Udén P. The browsing dromedary camel I. Behaviour, plant preference and quality of forage selected. Anim Feed Sci Technol; 121: 297–308: (2005)
    CrossRef
  16. Diederichsen A. Assessments of genetic diversity within a world collection of cultivated hexaploid oat (Avena sativa L.) based on qualitative morphological characters. Genet Resour Crop Evol; 55: 419-440: (2008)
    CrossRef
  17. Doyle J. J, Doyle J. L. Isolation of plant DNA from fresh tissue. Focus; 12: 13-15(1990)
  18. El Finti A, Belyadi M, El Boullani R, Msanda F, Serghini M. A, El Mousadik A. Genetic structure of cactus pear (Opuntia ficus indica) in Moroccan collection. Asian J Plant Sci; 12: 145-148: (2013)
    CrossRef
  19. Elhoumaizi M. A, Saaidi M, Oihabi A, Cilas C. Phenotypic diversity of date-palm cultivars (Phoenix dactylifera L.) from Morocco. Genet Resour Crop Evol; 49: 483-490: (2002)
    CrossRef
  20. El-Mostafa K, El Kharrassi Y, Badreddine A, Andreoletti P, Vamecq J, El Kebbaj M. S, Latruffe N, Lizard G, Nasser B, Cherkaoui-Malki M. Nopal cactus (Opuntia ficus-indica) as a source of bioactive compounds for nutrition, health and disease. Molecules;19: 14879-14901: (2014)
    CrossRef
  21. Erre P, Chessa I, Nieddu G, Jones P. G. Diversity and spatial distribution of Opuntia spp. in the Mediterranean Basin. J Arid Environ; 73: 1058-1066: (2009)
    CrossRef
  22. Felker P, del C Rodriguez S, Casoliba R. M, Filippini R, Medina D, Zapata R. Comparison of Opuntia ficus indica varieties of Mexican and Argentine origin for fruit yield and quality in Argentina. J Arid Environ; 60: 405-422: (2005)
    CrossRef
  23. Feugang J. M, Konarski P, Zou D, Stintzing F. C, Zou C. Nutritional and medicinal use of Cactus pear (Opuntia spp.) cladodes and fruits. Front Biosci; 11: 2574-2589: (2006)
    CrossRef
  24. Hartings H, Berardo N, Mazzinelli G. F, Valoti P,  Verderio A, Motto M. Assessment of genetic diversity and relationships among maize (Zea mays L.) Italian landraces by morphological traits and AFLP profiling. Theor Appl Genet; 117: 831–842: (2008)
    CrossRef
  25. Helsen P, Browne R. A, Anderson D. J, Verdyck P, Van Dongen S. Galápagos’ Opuntia (prickly pear) cacti: extensive morphological diversity, low genetic variability. Biol J Linnean Soc; 96: 451–461: (2009)
    CrossRef
  26. Kölliker R, Jones E. S, Jahufer M. Z. Z, Forster J. W. Bulked AFLP analysis for the assessment of genetic diversity in white clover (Trifolium repens L.). Euphytica; 121: 305-315: (2001)
    CrossRef
  27. Labra M, Grassi F, Bardini M, Imazio S, Guiggi A, Citterio S, Banfi E, Sgorbati S. Genetic relationships in Opuntia Mill. genus (Cactaceae) detected by molecular marker. Plant Sci; 165: 1129-1136: (2003)
    CrossRef
  28. Lee M. DNA markers and plant breeding programs. Adv Agron; 55: 265–344: (1995)
    CrossRef
  29. Malik S. K, Rohini M. R, Kumar S, Choudhary R, Pal D, Chaudhury R. Assessment of genetic diversity in sweet orange [Citrus sinensis (L.) Osbeck] cultivars of India using morphological and RAPD markers. Agri Res; 1: 317–324: (2012)
    CrossRef
  30. Mohamed-Yasseen Y, Barringer S. A, Splittstoesser W. E. A note on the uses of Opuntia spp. in Central/North America. J Arid Environ; 32: 347 –353: (1996)
    CrossRef
  31. Peña-Valdivia C. B, Luna-Cavazos M, Carranza-Sabas J. A, Reyes-Agüero J. A, Flores A. Morphological characterization of Opuntia spp.: a multivariate analysis. J Prof Assoc Cactus Dev; 10: 1-21. (2008)
  32. Piga A. Cactus pear: a fruit of nutraceutical and functional importance. J Prof Assoc Cactus Dev; 6: 9-22: (2004)
  33. Realini M. F, Gonzalez G. E, Font F, Picca P. I, Poggio L, Gottlieb A. M. Phylogenetic relationships in Opuntia (Cactaceae, Opuntioideae) from southern South America. Plant Syst Evol; doi: 10.1007/s00606-014-1154-1: (2014)
    CrossRef
  34. Rohlf F. J. NTSYSpc numerical taxonomy and multivariate analysis system version 2.1, users guide. Exeter Software. Setauket, New York; (2000)
  35. Sedra M. H, Lashermes P, Trouslot P, Combes M.C, Hamon S. Identification and genetic diversity analysis of date palm (Phoenix dactylifera L.) varieties from Morocco using RAPD markers. Euphytica; 103: 75–82: (1998)
    CrossRef
  36. Semagn K, Bjørnstad A, Ndjiondjop M. N. An overview of molecular marker methods for plants. Afr J Biotechnol; 5: 2540-2568: (2006)
  37. Shahnejat-Bushehri A. A, Torabi S, Omidi M, Ghannadha M. R. Comparison of Genetic and Morphological Distance with Heterosis with RAPD Markers in Hybrids of Barley. Int J Agri Biol; 7592-595: (2005)
  38. Talebi R, Fayyaz F. Quantitative evaluation of genetic diversity in Iranian modern cultivars of wheat (Triticum aestivum L.) using morphological and amplified fragment length polymorphism (AFLP) markers. Biharean Biol; 6: 14-18: (2012)
  39. Valadez-Moctezuma E, Samah S, Luna-Paez A. Genetic diversity of Opuntia spp. varieties assessed by classical marker tools (RAPD and ISSR). Plant Syst Evol; doi: 10.1007/s00606-014-1112-y: (2014)
    CrossRef
  40. West-Eberhard M. J. Phenotypic plasticity and the origins of diversity. Ann Rev Ecol Syst; 20: 249-278: (1989)
    CrossRef
  41. Williams J. G. K, Kubelik A. R, Livak K. J, Rafalski J. A, Tingey S. V. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucl Acids Res; 18: 6531 – 6535: (1990)
    CrossRef
  42. Yahia E. M, Mondragon-Jacobo C. Nutritional components and anti-oxidant capacity of ten cultivars and lines of cactus pear fruit (Opuntia spp.). Food Res Int; 44: 2311–2318: (2011)
    CrossRef
  43. Yawen, Z, Shiquan S, Zichao L, Zhongyi Y, Xiangkun W, Hongliang Z, Guosong W. Ecogeographic and genetic diversity based on morphological characters of indigenous rice (Oryza sativa L.) in Yunnan, China. Genet Resour Crop Evol; 50: 567–577: (2003)
    CrossRef
  44. Zoghlami N, Chrita I, Bouamama B, Gargouri M, Zemni H, Ghorbel A, Mliki A. Molecular based assessment of genetic diversity within Barbary fig (Opuntia ficus indica (L.) Mill.) in Tunisia. Sci Hortic; 113: 134-141: (2007)
    CrossRef
scroll to top